                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:87 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=39 nt.     Delta G= -8.71 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTTAAACCAAGCATTGGATAGAATCCAACTCCTCCGTAATCAGCTACGGACTAGTTC
TCGATACATTGTTGGATCGGAAGAGGAGTGTACGCCGTTGTTAGACGCAGAAGAAACT
TGTTGTTCTCTGGATTCAATTTGCTAAggtttctttagttacattaggaggcgtcctggtaagaggcttcttgccaggat
ttttttgcctagttttttcgtatgtatcgtccttgaattttttattttgttaaaaaactcttttttatattgttcccctgattttttactggaaaggaga
aaaaATG

    TC0495 Gene: TC0495     GI: 15835113     BI number: TC0495     GOG: NOG14440     Description: hypothetical protei   t t  t gc gt At At        gc Ta       g  g Cg        at Gt        gc T  t       gc T  a       at T  c       tg A  |       tg A  |       at C  |      c  | T  |      a  |       gc Ta       t  |      g  t At       t  |      a  t Gt       g  |       gc G  a      a  |       at Tg       t  |       at Cg        ta        tg Ta        ta        gc Cg        cg        gc T  |       ta        ta Tg        tg        cg Gc        tg        cg Tg        gc        ta                         tttttttgcctagttttttcgtatgtatcgtccttgaattttttattttgttaaaaaactcttttttatattgttcccctgattttttactggaaaggagaaaaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:99 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-17.30 kcal/mol Antiterminator: Size=39 nt.     Delta G= -8.71 kcal/mol Anti-antiterminator:   Size=51 nt.     Delta G=-10.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTTTAAACCAAGCATTGGATAGAATCCAACTCCTCCGTAATCAGCTACGGACTAGTTC TCGATACATTGTTGGATCGGAAGAGGAGTGTACGCCGTTGTTAGACGCAGAAGAAACT TGTTGTTCTCTGGATTCAATTTGCTAAggtttctttagttacattaggaggcgtcctggtaagaggcttcttgccaggat ttttttgcctagttttttcgtatgtatcgtccttgaattttttattttgttaaaaaactcttttttatattgttcccctgattttttactggaaaggaga aaaaATG     TC0495 Gene: TC0495     GI: 15835113     BI number: TC0495     GOG: NOG14440     Description: hypothetical protei AT G  T GC TA        ta C  A      t  c T  T       ga C  T       at T  T       tt TG        ta GC        tg T  T       cg T  A       ta G  |      t  |       gc TA       t  |      g  t Tg       g  |      a  t Cg       g  |       gc At       A  |       at At       A  |       at At       T  |       tg Gc        Cg        gc At        Gg        gc At        Tc        ta Gt        Tg        cg A  a       Tt        cg Cg        Ac        ta Gt        Ac        gt                         ttttttgcctagttttttcgtatgtatcgtccttgaattttttattttgttaaaaaactcttttttatattgttcccctgattttttactggaaaggagaaaaaATG     ..................................................................................................................