Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:79 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=69 nt.     Delta G=-14.12 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -7.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCGGCAAGATAAAGAGCGATGCGTAAGTTGTTTTCAGAAGCAATTGAAACAGAGTCAA
GATACTTGCGAGCGATTAACTAGAGCATTATGTAATGCTAAAAATCAGTGTGCTGAAT
TAGAGAAAGAATTGGCTTGTGTTAAAGCTAAGAAGAAGTAAgaaggttatccattattttagtagttttt
ttttgaaaagccctcctttattcggagggcttttttgggtttaaattggaatcttttaatcttgtttagtttgcacattgcagggaatcaaggttttgcg
aataaaaatttcgtTTG

    TC0499


Gene: TC0499     GI: 15835117     BI number: TC0499     GOG: NOG12195     Description: hypothetical protei


           ga
          t  a
           ta
           ta
          t  g
          t  |
          t  |
           tc
           tc
           tc
           gt
           ac
           tc
 ta        gt
t  t      a  t
 gc       t  t
 gc       t  |
a  a      t  |
a  |       ta
g  |       a
 At        t
 At        t
 Ta        a
 Gt        c
 At        c
 At       |
 Gt       |          a
A  a      |        t  t
A  g      t        t  t
G  |      a        t  c
A  |      t         cg
 At       t         cg
 Ta       g         ta
 Cg        g        cg
 Gt        a        cg
 At        a        cg
 At        g        gc
 At        A        at
                        tttttgggtttaaattggaatcttttaatcttgtttagtttgcacattgcagggaatcaaggttttgcgaataaaaatttcgtTTG


    ..................................................................................................................