                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:45 nt.    Distance to gene:26 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-14.40 kcal/mol
Antiterminator:    Distance from promoter:11 nt. Size=46 nt.     Delta G= -6.70 kcal/mol
Anti-antiterminator:   Size=43 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tggaga-taccat. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggagatgaaaatgtttttgggctaccatcgaatgtctttgcatctcaatcatcgggtcttttcgtttgatagtgattagccttgcaaggtacgcaaggc
tggctcttttttatgattaccccaaaatagaatgatttATG

    TC0502 Gene: TC0502     GI: 15835120     BI number: TC0502     GOG: COG0733     Description: sodium-dependent transporter, putativ             c           t  g           t  t ct       t  t g  a      t  t gc        cg gc        ta ta        gt |  t      g  a t  c      g  |        g tg       c  |      g  t ta        tg       a  a ta        at       a  c gt        cg        cg tg        ta        gc at        at        ta |  c       at        ta at       c  |       cg at        ta        cg at        cg        gc |  g      |  c       at gc       |  c       tg ta       t  t       tg at        at       |  c gc        cg        at at        gc        gc                         ttttttatgattaccccaaaatagaatgatttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0733 Na+-dependent transporters of the SNF family ... can be seen here     ..................................................................................................................