                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:108 nt.     Distance to run of Ts=0 nt.   Size=22 nt.     Delta G=-10.30 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -5.10 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-13.31 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

agcggtttgtgcttctcgccctaagtccttctaaattttttatttaggaggcattttgttggctgttatacagccggaatacagtagctgtgcaggatgc
tcagtttactaagaacccttacgcatagaatgtgcgaaagagtagacttgtagggattagttattctagctttgaacaaagctagatttttttgctgtag
actctgcgagaaaaccaatggttgttttgagcagccataagtcgtccatctgcttaagatggaaggcgcttcattttgaaatgaaagtaaggatcatagg
ATG

    acpP Gene: acpP     GI: 15835125     BI number: TC0507     GOG: COG0236     Description: acyl carrier protei   a g  a a  t tg at cg gc cg a  a ta ta cg c  |       gg c  |      a  g a  |       ta a  |       gt g  |      t  t a  |       ta a  |       cg ta        at cg        gt at       a  |       aa ta        ta       g  c tg        gt        ta ta        at        ta gc        gc        ta at        at        cg c  t      a  a       gc t  |      a  |       at cg       g  |       ta gt        cg        cg ta        gc        ta                         tttttttgctgtagactctgcgagaaaaccaatggttgttttgagcagccataagtcgtccatctgcttaagatggaaggcgcttcattttgaaatgaaagtaaggatcataggATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [IQ] COG0236 Acyl carrier protein ... can be seen here     ..................................................................................................................