                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:172 nt.    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -7.20 kcal/mol
Antiterminator:    Distance from promoter:141 nt. Size=40 nt.     Delta G=-13.80 kcal/mol
Anti-antiterminator:    Distance from promoter:100 nt.    Size=53 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGTA-TATTGT. It has a score value of 63.59 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGTATTTTGATCCTATGAATTATTGTTTAGGATATTTGGAAAATAAATACATGCCA
GCCTAAtttagtctcacaggatccctagggaaaggcatttatacagccttcccgaagggatccttttgagtctaggaggacttgataaaatctttc
gtaataagtaccatgaggcattctggggaaaactccttccccattaaggaatcctataagagtagatttccttttttcttaataaattttctcaaaaaag
aagggcctcTTG

    TC0556 --- gcvH Gene: TC0556     GI: 15835173     BI number: TC0556     GOG: NOG04990     Description: conserved hypothetical protein Gene: gcvH     GI: 15835172     BI number: TC0554     GOG: COG0509     Description: glycine cleavage system H protei   t g  a c  a t  t ta ta        ct cg       a  c t  t      a  c a  a       at a  c       at a  c       gc a  |       gc ta        gc at        gc g  g      |  a ta       |  t       ag tg       |  t      a  a cg       |  a       tg a  c      |  a       at g  a       tg        ta g  |       cg        cg at        ta       c  a gt        ta       t  t gc        at        at at       c  |       at tg        gc        gc cg        gc        gc tg        at        at                         tttttcttaataaattttctcaaaaaagaagggcctcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0509 Glycine cleavage system H protein (lipoate-binding) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:171 nt.    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -8.10 kcal/mol Antiterminator:    Distance from promoter:137 nt. Size=40 nt.     Delta G=-13.80 kcal/mol Anti-antiterminator:    Distance from promoter:100 nt.    Size=53 nt.     Delta G= -6.30 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: TTGGTA-TATTGT. It has a score value of 63.59 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTGGTATTTTGATCCTATGAATTATTGTTTAGGATATTTGGAAAATAAATACATGCCA GCCTAAtttagtctcacaggatccctagggaaaggcatttatacagccttcccgaagggatccttttgagtctaggaggacttgataaaatctttc gtaataagtaccatgaggcattctggggaaaactccttccccattaaggaatcctataagagtagatttccttttttcttaataaattttctcaaaaaag aagggcctcTTG     TC0556 --- gcvH Gene: TC0556     GI: 15835173     BI number: TC0556     GOG: NOG04990     Description: conserved hypothetical protein Gene: gcvH     GI: 15835172     BI number: TC0554     GOG: COG0509     Description: glycine cleavage system H protei   t g  a c  a t  t ta ta        aa cg       g  a t  t      g  a a  a       gc a  c       gt a  c       tc a  |       cc ta        tt at        tt g  g      |  c       ag ta       |  c      a  a tg       |  c       tg cg       |  c       at a  c      |  a       ta g  a       at        cg g  |       ct       c  a at        ga       t  t gt        ga        at gc        ag        at at       g  |       gc tg        tg        gc cg        aa        at tg        ca        at                         ttttcttaataaattttctcaaaaaagaagggcctcTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0509 Glycine cleavage system H protein (lipoate-binding) ... can be seen here     ..................................................................................................................