Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:94 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-12.30 kcal/mol
Antiterminator: Size=78 nt.     Delta G= -9.10 kcal/mol
Anti-antiterminator:   Size=46 nt.     Delta G= -8.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAACTTAATCACTTGCTTTGCGCGATTGGTAAACTTCTCAAACATAAAAACCTGAATA
TGGCGAGGTGGAATACTCTTCAGCATATACGACATttatgataatgatgcaacttttcgtaaagagggggtgtg
gcgtagcgtttttttgtaataaattttttttgatgtttgggtatctttgctaggggactagtattatctatttattagatcacgattctgatgtaatata
tttctgaaataaacaagagtagactgttctcggtttgtttatcagagattatagatatttattgcataATG

    TC0558 --- TC0557


Gene: TC0558     GI: 15835175     BI number: TC0558     GOG: COG0095     Description: conserved hypothetical protein
Gene: TC0557     GI: 15835174     BI number: TC0557     GOG: COG1502     Description: phospholipase D family protei


            a
          t  a
          a  a
          a  t
          t  t
          g  t
          t  t
          t  t
          t  t
          t  t
          t  t
           tg
           ta
           gt
           cg
          |  t
           gt
           at
           tg
          g  g
  a        cg
t  a       gt
g  a      g  a
 cg       t  |
 ta       g  |
 tg       t  |
 tg       g  |       gg
 tg       g  |      g  a
 cg       g  |       gc
a  g      g  |       at
 at       g  |       ta
 cg        at        cg
 gt        gc        gt
t  g       at        ta
a  g       at       t  t
 gc        at       t  |
 tg        tg       c  |
 at        gc       t  |
a  a      c  t       at
t  g       ta        ta
a  |       tg        gt
 gc        tg        gc
 tg        tg        gt
 at        cg        ta
                        tttattagatcacgattctgatgtaatatatttctgaaataaacaagagtagactgttctcggtttgtttatcagagattatagatatttattgcataATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[H] COG0095 Lipoate-protein ligase A ... can be seen here
[I] COG1502 Phosphatidylserine/phosphatidylglycerophosphate/cardiolipin synthases and related enzymes ... can be seen here

    ..................................................................................................................