                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=41 nt.     Delta G= -7.00 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTGGGAGATGTCATTATTGCAGAACCTAAGGCTCTTATTTGCTTCGCAGGGCCACGA
GTGGTTTCTCAAGTAATAGGAGAAGATCTTCCAGAAGGAGCTCAGAAGTCTGAGTTTT
TATTGGAGCATGGGATGATCGATAAGGTCGTGGAGAGAAAACAGCTCAAAGCAACTTT
GGAAAGCTTGTTAAATTTTTTCAATTGTCAGGCGTATTCCTAAgggcaagacaaatcctctagaagta
gctctaagaccttttaggggattttttttgttgacagatgacaagcgaataaaagatcATG

    dut --- TC0564 --- TC0563 --- TC0562 Gene: dut     GI: 15835182     BI number: TC0565     GOG: COG0756     Description: deoxyuridine 5`-triphosphate nucleotidohydrolase Gene: TC0564     GI: 15835181     BI number: TC0564     GOG: COG1762     Description: PTS system, IIA component Gene: TC0563     GI: 15835180     BI number: TC0563     GOG: COG1762     Description: PTS system, IIA component Gene: TC0562     GI: 15835179     BI number: TC0562     GOG: NOG07056     Description: conserved hypothetical protei            ac           g  a           a  a        t           a  a      c  a           c  t       ta            gc        cg            gc       g  a TA       g  t      a  c G  T      A  c      t  | C  T       At        gc GC        Ta        at GC        Cg        at AT       C  a       gt |  A       Ta        at |  A       Tg        ta |  g       At        cg Cg        Ta        tg Tg       G  |       cg Gc        Cg        cg Ta        Gc        ta Ta        Gt        at                         tttttttgttgacagatgacaagcgaataaaagatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0756 dUTPase ... can be seen here [GT] COG1762 Phosphotransferase system mannitol/fructose-specific IIA domain (Ntr-type) ... can be seen here [GT] COG1762 Phosphotransferase system mannitol/fructose-specific IIA domain (Ntr-type) ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:182 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -7.80 kcal/mol Antiterminator: Size=43 nt.     Delta G= -5.20 kcal/mol Anti-antiterminator:   Size=48 nt.     Delta G=-13.90 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTTGGGAGATGTCATTATTGCAGAACCTAAGGCTCTTATTTGCTTCGCAGGGCCACGA GTGGTTTCTCAAGTAATAGGAGAAGATCTTCCAGAAGGAGCTCAGAAGTCTGAGTTTT TATTGGAGCATGGGATGATCGATAAGGTCGTGGAGAGAAAACAGCTCAAAGCAACTTT GGAAAGCTTGTTAAATTTTTTCAATTGTCAGGCGTATTCCTAAgggcaagacaaatcctctagaagta gctctaagaccttttaggggattttttttgttgacagatgacaagcgaataaaagatcATG     dut --- TC0564 --- TC0563 --- TC0562 Gene: dut     GI: 15835182     BI number: TC0565     GOG: COG0756     Description: deoxyuridine 5`-triphosphate nucleotidohydrolase Gene: TC0564     GI: 15835181     BI number: TC0564     GOG: COG1762     Description: PTS system, IIA component Gene: TC0563     GI: 15835180     BI number: TC0563     GOG: COG1762     Description: PTS system, IIA component Gene: TC0562     GI: 15835179     BI number: TC0562     GOG: NOG07056     Description: conserved hypothetical protei            GA GA       A  T C  G      A  C AT        GT CG        AT CG        GC GT        GC GT       A  | GT       T  | A  C      A  | C  T      A  | G  C      T  | C  |      G  | TA       A  | TA       A  | CG       C  | GT        TA T  |       CG        AG TA        TA       A  T TA        TA        GC AT        TG        AT TA       G  G       CG TG       G  A       TA CG        TG        CG TA        GC        GT CG        AT        AT                         TTTATTGGAGCATGGGATGATCGATAAGGTCGTGGAGAGAAAACAGCTCAAAGCAACTTTGGAAAGCTTGTTAAATTTTTTCAATTGTCAGGCGTATTCCTAAgggcaagacaaatcctctagaagtagctctaagaccttttaggggattttttttgttgacagatgacaagcgaataaaagatcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [F] COG0756 dUTPase ... can be seen here [GT] COG1762 Phosphotransferase system mannitol/fructose-specific IIA domain (Ntr-type) ... can be seen here [GT] COG1762 Phosphotransferase system mannitol/fructose-specific IIA domain (Ntr-type) ... can be seen here     ..................................................................................................................