                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:54 nt.    Distance to gene:24 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G=-10.10 kcal/mol
Antiterminator:    Distance from promoter:22 nt. Size=44 nt.     Delta G= -6.40 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-15.60 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaat-gataat. It has a score value of 64.26 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgaatcgttgttagggaatactcgttgataataaaagctccggtattttcggagcttttttatatgcattgagaaaagaagactggtctctggaaaagt
taatccagggaatttcttagttgaggttgcaagagtgcgttATG

    TC0583 --- atpA --- atpB --- atpD --- TC0579 Gene: TC0583     GI: 15835200     BI number: TC0583     GOG: NOG05142     Description: conserved hypothetical protein Gene: atpA     GI: 15835199     BI number: TC0582     GOG: COG1155     Description: ATP synthase, subunit A Gene: atpB     GI: 15835198     BI number: TC0581     GOG: COG1156     Description: ATP synthase, subunit B Gene: atpD     GI: 15835197     BI number: TC0580     GOG: COG1394     Description: ATP synthase, subunit D Gene: TC0579     GI: 15835196     BI number: TC0579     GOG: COG1269     Description: ATP synthase, subunit I, putativ            ag           a  a            gc   t        at a  t      a  g t  t      a  g gt        at gc        gc cg        at cg        gc ta       t  | cg       t  | gc       a  | at       c  | at       g  |       gt at       t  |      a  t at       a  |      a  a t  |      t  |      a  a at        at        at at        tg        gc ta        tg        gc at        ta        ta g  a       ta        cg t  t       ta        tg tg        ta        cg gc        cg        ta                         atttcttagttgaggttgcaagagtgcgttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1155 Archaeal/vacuolar-type H+-ATPase subunit A ... can be seen here [C] COG1156 Archaeal/vacuolar-type H+-ATPase subunit B ... can be seen here [C] COG1394 Archaeal/vacuolar-type H+-ATPase subunit D ... can be seen here [C] COG1269 Archaeal/vacuolar-type H+-ATPase subunit I ... can be seen here     ..................................................................................................................