                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:56 nt.    Distance to gene:14 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-11.00 kcal/mol
Antiterminator:    Distance from promoter:25 nt. Size=36 nt.     Delta G= -7.80 kcal/mol
Anti-antiterminator:   Size=62 nt.     Delta G=-10.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgaca-tataat. It has a score value of 85.01 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgacattttctatttagtcgatataatcgctctctcgagtttcctgaggatggcaggtgttatagtcctaacgaatattcaaacctgttttttatttcg
atcagggatcaagagataggatattttttaggtttttttaggaATG

    infA Gene: infA     GI: 15835214     BI number: TC0597     GOG: COG0361     Description: translation initiation factor ct t  c c  t gc cg ta a  g a  t t  t a  t t  c a  c gt cg         a         t ta       t  a      a  c g  |      c  c      g  a a  |       cg        cg tg        ta        tg tg       g  a       tg ta        at        ta at        ta        at tg        at       |  c cg       |  t       ta t  c      t  c       ta ta       t  a       tg tg       g  a       ta tg        ta        tg at        gc        ta cg        gc        gt at        at        ta gt        cg        cg ta        gt        cg                         atattttttaggtttttttaggaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0361 Translation initiation factor 1 (IF-1) ... can be seen here     ..................................................................................................................