                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:105 nt.    Distance to gene:100 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-22.40 kcal/mol
Antiterminator:    Distance from promoter:78 nt. Size=43 nt.     Delta G= -4.70 kcal/mol
Anti-antiterminator:    Distance from promoter:53 nt.    Size=40 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTCTTC-TACAAT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTCTTCAAACGTAGCTATTTTTTTACAATCGATGCATACCATTTCCATGCGGTCAGTC
GTGATTATCTACGGGAAGAAAGTAATAGACGGAGGATAGgacagagcttaggttagtggtttatgtgtata
gaaaagctctttgttagacctccaaaggtttaacaaagagctttttttttactcaattatagactctgtcatacctacggttgatagcgatatggggtta
ttagaaaagtttttagtagtaacagggggcgtatttagggggaattattATG

    TC0600 Gene: TC0600     GI: 15835217     BI number: TC0600     GOG: NOG09341     Description: conserved hypothetical protei            tg           g  t            ta            at            ta ag        tg c  a       ta a  g      |  a gc       g  a       ca Gt       g  a      c  a At        tg        ta Ta        gc        cg A  g       at        cg G  g      |  c       at Gt       |  t       gt At       |  t       at |  a      |  t       ta |  g      |  g       ta G  t      |  t       gc G  g      |  t       ta Cg       |  a       ta At        tg        ta Gt        ta        cg At        gc        ta Ta        gc        cg At        at        gc                         tttttttttactcaattatagactctgtcatacctacggttgatagcgatatggggttattagaaaagtttttagtagtaacagggggcgtatttagggggaattattATG     ..................................................................................................................