                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:136 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=46 nt.     Delta G= -6.80 kcal/mol
Anti-antiterminator:   Size=61 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTCTCTAGAGGAATATTTAAAAATTTTTCGTTTGTTAAAAGATTTTTAGtagttttgctcat
ctctacagaaaataaggcttctctttccaaatatcttcctttcgatcacaatattcgctctaggtgtcttggatgcttatagcattctttttgtggtgtt
ttcgttagccaatgtttttcacatgaactttgaacaggctaaaggataatgttggaagatgctgtttaattgtttttagatcataggtttacaaacggcc
tatctttttaagtttttgtgtgggaagctttgggattATG

    def Gene: def     GI: 15835247     BI number: TC0632     GOG: COG0242     Description: polypeptide deformylas ta c  c ta cg ta a  a c  a t  a c  | gt         a ta       c  a ta       a  t tg       c  a tg       t  t gc        at at        gc t  t       cg Gc       t  c At       t  t |  c      t  c |  t      c  t        t |  t      c  |      t  g |  t      t  |       cg |  c       ta        ta |  c       cg        gt Ta        tg        tg Ta        at        gc Ta        tg        gt T  t       at        at Ta       |  c       ta At        at       c  t Gc        at        ta At        cg        cg At        cg        gc                         attctttttgtggtgttttcgttagccaatgtttttcacatgaactttgaacaggctaaaggataatgttggaagatgctgtttaattgtttttagatcataggtttacaaacggcctatctttttaagtttttgtgtgggaagctttgggattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0242 N-formylmethionyl-tRNA deformylase ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:144 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -8.10 kcal/mol Antiterminator: Size=46 nt.     Delta G= -6.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTCTCTAGAGGAATATTTAAAAATTTTTCGTTTGTTAAAAGATTTTTAGtagttttgctcat ctctacagaaaataaggcttctctttccaaatatcttcctttcgatcacaatattcgctctaggtgtcttggatgcttatagcattctttttgtggtgtt ttcgttagccaatgtttttcacatgaactttgaacaggctaaaggataatgttggaagatgctgtttaattgtttttagatcataggtttacaaacggcc tatctttttaagtttttgtgtgggaagctttgggattATG     def Gene: def     GI: 15835247     BI number: TC0632     GOG: COG0242     Description: polypeptide deformylas   t a  c g  a c  c t  a ta tt ca c  t t  t t  c c  g        t t  |      t  g a  |       cg tc        ta at        gt ac        tg at        gc ca        gt cg        at |  g       ta tt       c  t tg        ta tt        cg cc        gc             attctttttgtggtgttttcgttagccaatgtttttcacatgaactttgaacaggctaaaggataatgttggaagatgctgtttaattgtttttagatcataggtttacaaacggcctatctttttaagtttttgtgtgggaagctttgggattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0242 N-formylmethionyl-tRNA deformylase ... can be seen here     ..................................................................................................................