                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-12.90 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -5.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATTGGTTTCTTAGATGTTCATGGTTATCTGGCCGCTAAAAAAGGACAGCAAGTCATG
CGGTCAGGATCAAGCATGTGGGTAGGATCCCAGGGACCTATCTTTTATAAAGTTTTTT
AGattccatttgtccgagcaaaaaaaaaccatctattgaacgatagatggttttttttgcttaagattttatatgagctagggacttgattcttttatt
ctccaaacgtatgttgggttcaaaattgattacaagcgtatcatgaagaatatatgcgttttgtaaaagcaagagagggtggtttATG

    mdh Gene: mdh     GI: 15835270     BI number: TC0655     GOG: COG0039     Description: malate dehydrogenas cg c  a tg gc ta ta ta |  a |  a |  a |  a a  a c  a c  c       aa t  c      g  c ta        tg at        ta Gc        at At        ta Ta        cg T  t       ta T  t       at Tg        cg Ta        cg Ta        at Gc        at             ttttttgcttaagattttatatgagctagggacttgattcttttattctccaaacgtatgttgggttcaaaattgattacaagcgtatcatgaagaatatatgcgttttgtaaaagcaagagagggtggtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0039 Malate/lactate dehydrogenases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-13.80 kcal/mol Antiterminator: Size=48 nt.     Delta G= -5.40 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CATTGGTTTCTTAGATGTTCATGGTTATCTGGCCGCTAAAAAAGGACAGCAAGTCATG CGGTCAGGATCAAGCATGTGGGTAGGATCCCAGGGACCTATCTTTTATAAAGTTTTTT AGattccatttgtccgagcaaaaaaaaaccatctattgaacgatagatggttttttttgcttaagattttatatgagctagggacttgattcttttatt ctccaaacgtatgttgggttcaaaattgattacaagcgtatcatgaagaatatatgcgttttgtaaaagcaagagagggtggtttATG     mdh Gene: mdh     GI: 15835270     BI number: TC0655     GOG: COG0039     Description: malate dehydrogenas tc g  c tg ta tg ac ca |  a |  a |  a |  a c  a t  a       aa t  a      g  c a  a       tg Gc        ta Ac        at Ta        ta Tt        cg Tc        ta T  t       at T  a       cg Tt        cg Gt        at Ag        at Aa        at             tttttgcttaagattttatatgagctagggacttgattcttttattctccaaacgtatgttgggttcaaaattgattacaagcgtatcatgaagaatatatgcgttttgtaaaagcaagagagggtggtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0039 Malate/lactate dehydrogenases ... can be seen here     ..................................................................................................................