Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:129 nt.    Distance to gene:88 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-15.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgacc-tattgt. It has a score value of 69.61 and is shown in blue

ttgacctgtagcttgctttgttattgtaggaagcttctcaaaggaagagttgcatatgctgatgaggcattatttcaagcctttcttacgacgctggtag
atgtaatttctgatattaagcaattgccgaatggatcagaataataaaaattttttgtgccctcttctttaaagagggcatttttctttttcataaaaat
ctttctatttcttttctcttctcagtgtgtatgatttgctctcgctaggaaaataagtaagaaaaggaaaaagatcccATG

    TC0661


Gene: TC0661     GI: 15835276     BI number: TC0661     GOG: COG2876     Description: phospho-2-dehydro-3-deoxyheptonate aldolase, putativ


           t
         t  t
         c  a
          ta
          ta
          cg
          ta
          cg
          cg
          cg
          gc
          ta
          gt
            ttttctttttcataaaaatctttctatttcttttctcttctcagtgtgtatgatttgctctcgctaggaaaataagtaagaaaaggaaaaagatcccATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG2876 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase ... can be seen here

    ..................................................................................................................