                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:120 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-14.90 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -8.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TATTGATCGCTTACGAGATATTATCGGTACTCCTATGAACATTTTAGGAGATTCTGTT
GTTGCGTTATATGTCGCTAATGGAGAAGGAGAGTTGGCTTCTCCAGAAGAAGAGGAAG
CTCTTCCTCAAAATGGTTAGaagacgtttttaacgaagagagaaaactctcttcgttttctttttaagattccctgaattctttt
ctgtagcttcaaaaagtgtttagtgtaacatgagaaatattttaacgtcttatgggccattagatcttcaagagatcgtttcttatctgtaaaaagataT
TG

    TC0680 --- TC0679 Gene: TC0680     GI: 15835295     BI number: TC0680     GOG: COG0508     Description: 2-oxo acid dehydrogenase, E2 component, lipoamide acyltransferase Gene: TC0679     GI: 15835294     BI number: TC0679     GOG: COG0517,COG0794     Description: carbohydrate isomerase, KpsF/GutQ famil             G           A  a           T  a           T  g           G  a            Gc            Tg            At            At        aa            At       a  a AA        At        gc G  G      |  t       at GC       C  a       gc AT       T  a       at GC       C  c       gc AT        Cg        at AT        Ta        at GC        Ta        gc A  C       Cg        cg AT        Ta        at GC        Cg        at                         ttctttttaagattccctgaattcttttctgtagcttcaaaaagtgtttagtgtaacatgagaaatattttaacgtcttatgggccattagatcttcaagagatcgtttcttatctgtaaaaagataTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG0508 Pyruvate/2-oxoglutarate dehydrogenase complex, dihydrolipoamide acyltransferase (E2) component, and related enzymes ... can be seen here [R] COG0517 FOG: CBS domain ... can be seen here [M] COG0794 Predicted sugar phosphate isomerase involved in capsule formation ... can be seen here     ..................................................................................................................