                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:147 nt.    Distance to gene:53 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.10 kcal/mol
Antiterminator:    Distance from promoter:98 nt. Size=53 nt.     Delta G=-17.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: atgatt-taatat. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgattttttttcaaaagtcgcctaatatctgtgggacgcccaagataccatggtttttattttaatggataaaatcctgtctcttgttctgaaaagatc
ccattttttggaaaggtttttctctataggcggtctcggagtataatcattttttgattataagcaaccgtagtttgcctcaatgtgatccagaggcttt
ttcgtgtatctagtttcttaagttactaagaattattttgtcacagcctagcaaaggtgtttggttatccATG

    ribE --- TC0684 --- TC0683 Gene: ribE     GI: 15835300     BI number: TC0685     GOG: COG0307     Description: riboflavin synthase, alpha subunit Gene: TC0684     GI: 15835299     BI number: TC0684     GOG: COG1092     Description: conserved hypothetical protein Gene: TC0683     GI: 15835298     BI number: TC0683     GOG: COG0566     Description: spoU rRNA methylase family protei   t t  t t  t at cg ta at at ta at ta |  a |  g |  c g  a a  a gc gc cg         g |  t      t  a ta       g  t cg       t  c t  t      a  c gt       a  a gt        cg cg        ta gc        cg gc        cg at        gc             tttttcgtgtatctagtttcttaagttactaagaattattttgtcacagcctagcaaaggtgtttggttatccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [R] COG1092 Predicted SAM-dependent methyltransferases ... can be seen here [J] COG0566 rRNA methylases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:147 nt.    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.10 kcal/mol Antiterminator:    Distance from promoter:106 nt. Size=53 nt.     Delta G=-17.90 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: atgatt-taatat. It has a score value of 64.93 and is shown in blue Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case atgattttttttcaaaagtcgcctaatatctgtgggacgcccaagataccatggtttttattttaatggataaaatcctgtctcttgttctgaaaagatc ccattttttggaaaggtttttctctataggcggtctcggagtataatcattttttgattataagcaaccgtagtttgcctcaatgtgatccagaggcttt ttcgtgtatctagtttcttaagttactaagaattattttgtcacagcctagcaaaggtgtttggttatccATG     ribE --- TC0684 --- TC0683 Gene: ribE     GI: 15835300     BI number: TC0685     GOG: COG0307     Description: riboflavin synthase, alpha subunit Gene: TC0684     GI: 15835299     BI number: TC0684     GOG: COG1092     Description: conserved hypothetical protein Gene: TC0683     GI: 15835298     BI number: TC0683     GOG: COG0566     Description: spoU rRNA methylase family protei   a t  t t  a aa gg tc ta ta tc tc tg |  t |  a |  g a  t c  t tt ag ac         g |  c      t  a tt       g  t ac       t  c t  a      a  c ga       a  a at        cg gg        ta g        cg c        cg t        gc             tttttcgtgtatctagtttcttaagttactaagaattattttgtcacagcctagcaaaggtgtttggttatccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0307 Riboflavin synthase alpha chain ... can be seen here [R] COG1092 Predicted SAM-dependent methyltransferases ... can be seen here [J] COG0566 rRNA methylases ... can be seen here     ..................................................................................................................