Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:44 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-21.30 kcal/mol
Antiterminator: Size=72 nt.     Delta G= -9.75 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -9.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTCTCCTGGACTGCTAATGGCTGCCAAGTCCCAACCTCAGCACATACAATAGCGAAC
CAACTAATCCTTCGCTATAAAGCCTGCTCCCTATACGTAAATGCAGTAGCTACCAAAC
TAGAAAGCACATATCTCTCAAGCAGCTTATCTTGCGGAGGCTATGTTGGTTTCTAAtc
tgaccttagggatgcacaatttttaaaacctccacatcttcatggtaaattaggcaaggaataccttgcctaatttacttttctgatttatctaacgcct
attaagatcgtacgtattcaataggtTTG

    pmpB/C


Gene: pmpB/C-1     GI: 15835309     BI number: TC0694     GOG: NOG43380     Description: polymorphic membrane protein B/C famil


           ta
          t  a
          t  a
          t  a
          t  c
          a  c
          a  t
          c  c
          a  c
          c  a
           gc
           ta
           at
           gc
  T        gt
T  T       gt
 GC       a  c
 GT       t  a
 TA       t  t
 TA        cg
 Gt        cg
T  c       at        at
 At       |  a      a  a
 Tg       |  a       gc
C  a      |  a       gc
 Gc       |  t       at
 Gc        gt        at
 At        ta        cg
 Gt        cg        gc
G  a       tg        gc
C  |      A  c       at
G  |      A  a       ta
 Tg        Ta        ta
 Tg        Cg        at
 Cg        Tg        at
 Ta        Ta        at
 At        Ta        ta
 Tg        Gt        gc
                        ttttctgatttatctaacgcctattaagatcgtacgtattcaataggtTTG


    ..................................................................................................................