                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:75 nt.    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-17.60 kcal/mol
Antiterminator:    Distance from promoter:17 nt. Size=61 nt.     Delta G= -4.90 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G= -6.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGCTT-TGTAAT. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGCTTTAGTGGATGGTATCGTTGTAATGAAAAAAACAGATCGTACTTACGTTTCTGT
TATACCTCAAGCTTAGtctagttttatttataattcagtttgttcgagctctgtttttgcataaacgtaaaaatagggctttttttta
tttgtctcaggacttgtttcATG

    TC0699 Gene: TC0699     GI: 15835314     BI number: TC0699     GOG: COG0536     Description: GTP-binding protein, GTP1/Obg famil            Gt           A  c           T  t            Ta            Cg            Gt            At            At           C  t           T  a           C  t           C  t CT        At A  T       Ta TA        At GC        Ta        aa CG        Ta       t  a |  T      |  t      a  c T  T      |  t       cg AT        Gc        gt GC        Ta        ta AT        Cg        ta CG       T  t       ta AT       T  t       ta AT       T  |       ta |  A       Gt        gt A  T       Cg        ta A  A       At        cg A  C      |  t       tg A  C      |  c       cg AT        Tg        gc GC        Ta        at TA        Cg        gt                         ttttttatttgtctcaggacttgtttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0536 Predicted GTPase ... can be seen here     ..................................................................................................................