Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -6.90 kcal/mol
Antiterminator: Size=65 nt.     Delta G= -9.41 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATCTGACATTACTTTTTTAGATATGAAAATTGAAGACGCATTCAAATACGTGATCTCT
TGTGGAGTATTAAATTCGGACCCCTGTGCTTCTTCTCCATTCATAAACCCCAAATCCT
AAtactcctaccggcatccacttcatgaaaagagaagatttagtcatcatcccgcttagagctctattgaaaaaaaaacagcgctctactattctattc
ccttcatgagcaacagcgaagttgccattttctttttaaatccctttccatccggaaaggaagaaagatcttgttgggttattttATG

    TC0703 --- TC0704 --- TC0705


Gene: TC0703     GI: 15835318     BI number: TC0703     GOG: NOG09585     Description: conserved hypothetical protein
Gene: TC0704     GI: 15835319     BI number: TC0704     GOG: NOG08096     Description: conserved hypothetical protein
Gene: TC0705     GI: 15835320     BI number: TC0705     GOG: COG0319     Description: conserved hypothetical protei


 aa
a  a
a  a
g  a
 ta
 ta
a  c
 ta
 cg
t  c
 cg
 gc
 at
 gc
 at
 ta
|  c
|  t
|  a
|  t
|  t
|  c
|  t
|  a
|  t
|  t
|  c
|  c
|  c
|  t
|  t
|  c
|  a
|  t       cg
|  g      g  a
|  a      a  a
|  g       cg
|  c       at
|  a       at
|  a       cg
|  c       gc
 ta       a  |
 cg        gc
 gc        ta
 cg        at
            tttctttttaaatccctttccatccggaaaggaagaaagatcttgttgggttattttATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[R] COG0319 Predicted metal-dependent hydrolase ... can be seen here

    ..................................................................................................................