                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-27.70 kcal/mol
Antiterminator: Size=71 nt.     Delta G=-17.46 kcal/mol
Anti-antiterminator:   Size=42 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGAGTTTTCTGTAACGTTGAAAGCAGTATCCGCTGGAGATGCTCGTGGGGAAGCTATT
CTTTCTTCCGATACATTGACAGTTCCTGTATCTGATACGGAGAATACACATATCTATT
AAtctttgaatttcaaatagatgtgtgaaaaagccgcccaagagatgtcttgggcggctttttttattttctgaaaaaaaatatttttttcattttcct
gctcagagagctttctaaatgggttttgtaaaaataaatgtttttgcttagactccttgtccgataactcaaataggagagggaaATG

    srp Gene: srp     GI: 15835341     BI number: TC0726     GOG: NOG08722     Description: Sr             g           t  a           t  a           t  t           c  t           t  t           A  c           A  a            Ta            Ta            At            Ta            Cg   T        Ta T  C       At GC        Tg AT        At CG        Cg        at AT        At       g  g G  A       Cg        at T  T      A  a       gc T  C      T  a       at AT       A  a       at CG       A  a       cg A  |      G  a       cg TA       A  g       cg AT        Gc        gc |  A       Gc        cg GC        Cg        cg CG       A  c       gc CG       T  c       at T  |      A  c       at TA       G  a       at CG        Ta        at TA        Cg        at TA        Ta        gt                         tattttctgaaaaaaaatatttttttcattttcctgctcagagagctttctaaatgggttttgtaaaaataaatgtttttgcttagactccttgtccgataactcaaataggagagggaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:121 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G=-22.80 kcal/mol Antiterminator: Size=71 nt.     Delta G=-17.46 kcal/mol Anti-antiterminator:   Size=39 nt.     Delta G=-11.26 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AGAGTTTTCTGTAACGTTGAAAGCAGTATCCGCTGGAGATGCTCGTGGGGAAGCTATT CTTTCTTCCGATACATTGACAGTTCCTGTATCTGATACGGAGAATACACATATCTATT AAtctttgaatttcaaatagatgtgtgaaaaagccgcccaagagatgtcttgggcggctttttttattttctgaaaaaaaatatttttttcattttcct gctcagagagctttctaaatgggttttgtaaaaataaatgtttttgcttagactccttgtccgataactcaaataggagagggaaATG     srp Gene: srp     GI: 15835341     BI number: TC0726     GOG: NOG08722     Description: Sr             g           a  c           a  c           a  g           a  c           a  c           g  c           t  a            ga            tg            ga            tg            aa            gt            ag            t   g        a t  a       a t  a       a t  t       c c  t      t t  t      t A  c      t         at A  a      a        g  g Ta       a         at Ta       g         gc At        t        at Ta        t        at Cg        t        cg Ta       c         cg At       t         cg Tg       A         gc At       A         cg Cg        T        cg At        T        gc Cg        A        at                         ttttttattttctgaaaaaaaatatttttttcattttcctgctcagagagctttctaaatgggttttgtaaaaataaatgtttttgcttagactccttgtccgataactcaaataggagagggaaATG     ..................................................................................................................