Gene putatively regulated by attenuation in C_muridarum
Characteristics of the secondary structures
Terminator: Distance from promoter:96 nt. Distance to gene:77 nt. Distance to run of Ts=0 nt. Size=35 nt. Delta G=-10.20 kcal/mol
Antiterminator: Distance from promoter:70 nt. Size=44 nt. Delta G= -7.60 kcal/mol
Anti-antiterminator: Distance from promoter:40 nt. Size=52 nt. Delta G=-13.40 kcal/mol
Nomenclature/Definitions
The most likely promoter is: ttgatt-gagaat. It has a score value of 72.96 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
ttgattaataagttttttgttgggagaatattactttctctttttaaatggtttaagatttttttggatggcgctcgccgctatcctggaaagagaaaaa
ctaaacatagtgggaagggcttgtccgctctagagatgtaggtaggcgctctatggggtgttttttaggagataacaggggcccaagcctaaaaaagaaa
aggatgtgtttttaagtggacgggggaggactaaacagtcgtATG
euo
Gene: euo GI: 15835346 BI number: TC0731 GOG: NOG05887 Description: euo protei
ga
g a
ta
cg
| a
cg
ta
| a
| a
| a tt
| a c g
| c gt
| t gc
| a gc gt
| a | g g a
| a a c a g
| c at tg
| a gc gc
at gt tg
ta g a a |
cg t g gc
gt g a at
cg a g gc
cg ta at
g g at | a
c a cg | t
ta at tg
cg a a cg
g g a | tg
cg tg cg
gc cg gt
gt at cg
ttttttaggagataacaggggcccaagcctaaaaaagaaaaggatgtgtttttaagtggacgggggaggactaaacagtcgtATG
..................................................................................................................