                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-24.70 kcal/mol
Antiterminator: Size=39 nt.     Delta G=-12.90 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G= -7.71 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATGACAACAGCGACCACCCTGTCTGTGTTGGTCATTTTGTTATTTGTTGGAGGTGGCT
CTATTTTCAATTTTGCGTTTATTATGACGGTAGGGATTTTGTTAGGAACGTTATCTTC
GTTATACATAGCTCCTCCGCTTCTCCTATTCATGGTGCGTAAGGAAGAACAGAATTCC
CTGCAGTAAataacgaaatgcgcttgggcgtatgtaatcctggaattatgggattattgctcctttcctcctgaaggaggaaaggagctttttt
ttaaaagagctcctctcctgggatgagagtatATG

    recJ Gene: recJ     GI: 15835347     BI number: TC0732     GOG: COG0608     Description: single-stranded-DNA-specific exonuclease Rec tg t  g cg gc cg gt ta at a  g a  t g  a       at c  a      a  t a  t      g  a a  c       gt t  c       tg a  t       cg        ga A  |       cg       t  a A  |       ta        cg T  |       at        cg G  |       at        ta A  |       ta        cg C  |       gt        cg G  |      t  |       ta T  |       at        ta C  |       tg        ta Cg        gc        cg Cg       c  t       cg Ta        gc        ta Ta        gc        cg At        gt        gc                         ttttttttaaaagagctcctctcctgggatgagagtatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0608 Single-stranded DNA-specific exonuclease ... can be seen here     ..................................................................................................................