                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:72 nt.    Distance to gene:103 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-11.80 kcal/mol
Antiterminator:    Distance from promoter:44 nt. Size=43 nt.     Delta G= -8.20 kcal/mol
Anti-antiterminator:    Distance from promoter:9 nt.    Size=41 nt.     Delta G= -7.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgatt-taaaag. It has a score value of 61.58 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgatttgattggaaaatagttaaaagcaattgttttgttctgataggaaggttctgaccgagcttatttctaagcgtcaaaaaaatgggggagactccg
ggctccttctcttgtcattgagagggttttccttttctaaaccatatgtttcgaagagcctagaacttctttcccgctgctttatcgtagggttaagtag
ctgcattcgcaaaattcacgaataacgaagagcctcataATG

    TC0733 Gene: TC0733     GI: 15835348     BI number: TC0733     GOG: COG0341,COG0342     Description: secDF protein, putativ ct        ag t  g      g  a ta        gc gc        gt gc        gc |  g       gc        tc a  a       tg       g  a a  g      a  g      t  t gc       a  g      t  t gt       a  c       cg at       a  t       ta ta       a  c       cg at       a  c       ta gt       a  t       tg |  t      c  t       cg |  c      t  c       cg t  t      g  t      |  t c  a      c  |      t  t ta        gc       c  t tg        at        gt gc        at        gc tg        tg        gc                         ttttctaaaccatatgtttcgaagagcctagaacttctttcccgctgctttatcgtagggttaagtagctgcattcgcaaaattcacgaataacgaagagcctcataATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [U] COG0341 Preprotein translocase subunit SecF ... can be seen here [U] COG0342 Preprotein translocase subunit SecD ... can be seen here     ..................................................................................................................