Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:212 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-18.90 kcal/mol

                                                                        Nomenclature/Definitions

AGAAACTTCTCAAGAAACAAAAGGCGAATAAtctgtttgatcgttttgtctgaaggagagttgatttttcgactctc
ctttttctttttaaaaaatctctttatccatacagcgcatcaatatattttttaatatcgctttcctcgtaattgaagaatcttgttcatgagaggaaaa
agcttttcttttgctataattctccaggtactagaattcaaaattcgaattgataaaagtattcgagacaaggtttgtctcttggcttttgggtgcgttt
tcaacgaatagaggagacaatgcATG

    TC0765 --- TC0764 --- TC0763


Gene: TC0765     GI: 15835379     BI number: TC0765     GOG: COG0747     Description: peptide ABC transporter, periplasmic peptide-binding protein, putative
Gene: TC0764     GI: 15835378     BI number: TC0764     GOG: COG0601     Description: peptide ABC transporter, permease protein, putative
Gene: TC0763     GI: 15835377     BI number: TC0763     GOG: COG1173     Description: peptide ABC transporter, permease protein, putativ


          tt
         t  t
          at
          gc
          tg
          ta
          gc
          at
          gc
          at
          gc
          gc
          at
          at
          gt
            ttctttttaaaaaatctctttatccatacagcgcatcaatatattttttaatatcgctttcctcgtaattgaagaatcttgttcatgagaggaaaaagcttttcttttgctataattctccaggtactagaattcaaaattcgaattgataaaagtattcgagacaaggtttgtctcttggcttttgggtgcgttttcaacgaatagaggagacaatgcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG0747 ABC-type dipeptide transport system, periplasmic component ... can be seen here
[EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here
[EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here

    ..................................................................................................................