Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G= -9.60 kcal/mol
Antiterminator: Size=68 nt.     Delta G=-10.82 kcal/mol
Anti-antiterminator:   Size=24 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTTCTGCGACTCGGTAAACAGAAACGGGCTTTTGATGTGATTTATGTGGATCCTCCCT
ATTCTTTAGAGAATGCATTTCTTCAAGAGGTCTTGTCGTATGTTGTGCAACAATCACT
ATTGGATCCTGAGGGCATTCTTTTTTTAGAAAATGCTGATACCCAAGAGATTATAGTG
AAAGGGTTAGAGCTCCGGAAACGTAGAAAATCTGGAGGGACTTTTCTTGCTGAGTATG
TCTTGGAAAGGGAAGCATAGacgaatttttcggaagccatgtctagtgggtagataaaaaattttctcTTG

    TC0773 --- hemH


Gene: TC0773     GI: 15835387     BI number: TC0773     GOG: COG0834     Description: amino acid ABC transporter, periplasmic amino acid-binding protein
Gene: hemH     GI: 15835386     BI number: TC0772     GOG: COG0276     Description: ferrochelatas


           AC
          T  C
          A  C
          G  A
           TA
           CG
          G  A
          T  G
          A  A
          A  T
          A  T
          A  A
          G  |
           AT
           TA
           TG
          T  T        A
           TG       T  G
           TA       G  A
           TA       C  A
           TA       A  A
           CG       A  A
           TG        AT
           TG        GC
           AT        GT
 TT       |  T       CG
T  T      |  A       CG
 TA       |  G       TA
 TG       |  A       CG
 TA        CG       G  G
C  A       GC       A  |
 TA        GT       G  |
 TA        GC       A  |
 AT       A  |       TG
 CG        GC        TA
 GC        TG        GC
 GT        CG        GT
                        TTTCTTGCTGAGTATGTCTTGGAAAGGGAAGCATAGacgaatttttcggaagccatgtctagtgggtagataaaaaattttctcTTG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[ET] COG0834 ABC-type amino acid transport/signal transduction systems, periplasmic component/domain ... can be seen here
[H] COG0276 Protoheme ferro-lyase (ferrochelatase) ... can be seen here

    ..................................................................................................................