Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:86 nt.     Distance to run of Ts=2 nt.   Size=33 nt.     Delta G=-19.80 kcal/mol

                                                                        Nomenclature/Definitions

GTAGTTGCTTGGTTAGGTAAAGAGTATTCTGTTAGAACCGCTGCTTTAGGTAAGGCGA
GGGCTGCTGAAGAGCCGTCTTTGCAGGATGAAGACGAGAGTAGAGTCTCCTCTCCTAT
ATCAGAGCCCGAAGCTCGAGAAGAGGTAGTAACAACTTTATAGtttgactaagaaaaagacctgggaa
agaacatcccaggtcttttaggtttttttgcttaaaaattctttttataatcctcatgttttagtaccgttttattcctaacgcgaaaagcgattaatag
atttatttgggttttcATG

    TC0781 --- polA --- TC0779


Gene: TC0781     GI: 15835395     BI number: TC0781     GOG: COG0616     Description: protease IV, putative
Gene: polA     GI: 15835394     BI number: TC0780     GOG: COG0258,COG0749     Description: DNA polymerase I
Gene: TC0779     GI: 15835393     BI number: TC0779     GOG: COG0237     Description: conserved hypothetical protei


           a
         g  a
         a  c
         a  a
          at
          gc
          gc
          gc
          ta
          cg
          cg
          at
          gc
          at
          at
          at
          at
            aggtttttttgcttaaaaattctttttataatcctcatgttttagtaccgttttattcctaacgcgaaaagcgattaatagatttatttgggttttcATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[OU] COG0616 Periplasmic serine proteases (ClpP class) ... can be seen here
[L] COG0258 5'-3' exonuclease (including N-terminal domain of PolI) ... can be seen here
[L] COG0749 DNA polymerase I - 3'-5' exonuclease and polymerase domains ... can be seen here
[H] COG0237 Dephospho-CoA kinase ... can be seen here

    ..................................................................................................................