                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:71 nt.     Distance to run of Ts=3 nt.   Size=36 nt.     Delta G=-10.00 kcal/mol
Antiterminator: Size=68 nt.     Delta G= -8.61 kcal/mol
Anti-antiterminator:   Size=30 nt.     Delta G= -3.34 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTAGCAGAAAGCGATATCCTTCCCTCCTTTAAGCAACGGATTCTTTTAACCAGTCTGC
GAATCCTTACCTCGTATCGGACCTATGTCCTTATCTTGCTTTTCTTTTTGCTCAATCG
AAAGAAAAAACATTCCCGAGCCACTAAAACTTTTTCTAACCCTTTTTTCTCTTAActct
ctatcttggaaatctttagcggactttttttccgcttttttctaagatttttgcgttgttagagaaagtctttttcctttcctgttctttctcaagatct
tttttagattgtgtaaaggactcttATG

    TC0840 --- TC0841 Gene: TC0840     GI: 15835454     BI number: TC0840     GOG: NOG12762     Description: hypothetical protein Gene: TC0841     GI: 15835455     BI number: TC0841     GOG: COG0144     Description: Nol1/Nop2/Sun family protei             T           C  T           T  A           C  A           T  c           T  t           T  c           T  t           T  c           T  t           C  a           C  t           C  c            At            At            Tg AA        Cg         t G  A       Ta       t  t CG        Ta       t  t TA        Ta       c  t |  A      T  t       at |  A      T  c       gc |  A      C  |       gc |  A      A  |       cg |  A       At        gc |  C       At        at |  A       At       t  t |  T       Ta       t  t |  T       Cg       t  | |  C      A  c      c  | A  C       Cg       t  | A  C       Cg        at CG       |  a       at TA        Gc        at CG        At        gc GC        Gt        gt                         aagatttttgcgttgttagagaaagtctttttcctttcctgttctttctcaagatcttttttagattgtgtaaaggactcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0144 tRNA and rRNA cytosine-C5-methylases ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_muridarum                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -7.40 kcal/mol Antiterminator: Size=68 nt.     Delta G= -8.61 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case CTAGCAGAAAGCGATATCCTTCCCTCCTTTAAGCAACGGATTCTTTTAACCAGTCTGC GAATCCTTACCTCGTATCGGACCTATGTCCTTATCTTGCTTTTCTTTTTGCTCAATCG AAAGAAAAAACATTCCCGAGCCACTAAAACTTTTTCTAACCCTTTTTTCTCTTAActct ctatcttggaaatctttagcggactttttttccgcttttttctaagatttttgcgttgttagagaaagtctttttcctttcctgttctttctcaagatct tttttagattgtgtaaaggactcttATG     TC0840 --- TC0841 Gene: TC0840     GI: 15835454     BI number: TC0840     GOG: NOG12762     Description: hypothetical protein Gene: TC0841     GI: 15835455     BI number: TC0841     GOG: COG0144     Description: Nol1/Nop2/Sun family protei   a a  t a  c g  t g  t t  t t  a c  g t  c a  g t  g c  a t  c ct tt ct A A T T C T C  | T  | T T T         t T       t  t T       t  t C        c  t C        at C        gc |         gc A        cg A        gc T        at             tttttctaagatttttgcgttgttagagaaagtctttttcctttcctgttctttctcaagatcttttttagattgtgtaaaggactcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0144 tRNA and rRNA cytosine-C5-methylases ... can be seen here     ..................................................................................................................