                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:43 nt.    Distance to gene:96 nt.     Distance to run of Ts=1 nt.   Size=25 nt.     Delta G=-16.00 kcal/mol
Antiterminator:    Distance from promoter:19 nt. Size=38 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTTT-TATAAA. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTTTTTGTGTTGACTCTACTCTATAAACTATCCGTTTAAtgagcgaattcgcaatgatttttaagaaa
caatcccttgctgaataagcaagggatcttcttttgctcaaagtacgatgcaaaacaacgctttacttctccaaaacaagtcgttcctttttatcttaaa
tcatatgcaagcttgggaacataaaaaagaTTG

    TC0843 Gene: TC0843     GI: 15835457     BI number: TC0843     GOG: COG0553     Description: helicase, Snf2 famil ag a  a ta ta t  c ta ta at         a gc       a  t |  c      g  a t  c       ta at        cg at        gc cg        ta gc        ta |  t       cg cg        cg ta        cg ta        ta at        at             cttcttttgctcaaagtacgatgcaaaacaacgctttacttctccaaaacaagtcgttcctttttatcttaaatcatatgcaagcttgggaacataaaaaagaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [KL] COG0553 Superfamily II DNA/RNA helicases, SNF2 family ... can be seen here     ..................................................................................................................