                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:27 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -9.70 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -5.40 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -6.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAGAAATTTCTTTTGAACGGTGAGTTTTTGGTGAAGGACCGTCCATGTGCATATGGA
AAGTGCGAACAGCGAGAAAAAAATCACCTTTCCAAAAAGATCGGCTTCCTGAAAGGAC
TGGATGATGGGATTGTTTGCGAGTTGGAACATaaggacatagacctaaccaacgagttcctagatgatcctaacaa
atttcttgtatagaaccaagatcctttttggtatgtaatttattgcaaaaacaaaaacaactcttctgttgtttttgtttttgctaaaccatagagagtg
ttgcgtttATG

    TC0884 Gene: TC0884     GI: 15835498     BI number: TC0884     GOG: COG4232,COG4233     Description: thiol:disulfide interchange protein DsbD, putativ            tt           t  a            at            at            tg            gc            ta           |  a           a  a           t  a cc       g  a t  t       gc at        ta        tt gt        ta       c  c at        ta       t  t at        ta        cg cg        ta        at cg       |  c       at at       c  a       cg a  a      c  a       at g  |      t  c       at at        at        at tg        gc        at at        at        at ta        at        cg                         tttttgctaaaccatagagagtgttgcgtttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [OC] COG4232 Thiol:disulfide interchange protein ... can be seen here [OC] COG4233 Uncharacterized protein predicted to be involved in C-type cytochrome biogenesis ... can be seen here     ..................................................................................................................