                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:170 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -9.80 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -8.60 kcal/mol
Anti-antiterminator:   Size=50 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTGAGTTAGGACTCGTTCGTTTAATTCTTTTGCAGCTTTGTTAGTGAATGTTATTGC
TAAAATTTGCGATGGATCGAGTTGAGCCTCTTCGATTAGGTAAAGAATTCGATGGGAA
ACCACTCGAGTTTTTCCAGCTCCAGCTCCAGCTAAAACAAGGACTGGTTGTAATGGCG
CAGTGACGGCGGTAACTTGTGCTGCATTTAATTCGGATGTAAGCATacgtacgtaatatatttttc
aggttcgaagaaaattttcgagaatgcatatactctatgcattagattaaggagagcgatATG

    ung --- TC0896 Gene: ung     GI: 15835511     BI number: TC0897     GOG: COG0692     Description: uracil-DNA glycosylase Gene: TC0896     GI: 15835510     BI number: TC0896     GOG: NOG09589     Description: conserved hypothetical protei AA A  T A  T T  T CG GC TG TA        CG AT       T  A TG       T  T TG       C  T G  A       TA T  |       CG A  |       CG AT        GT GC       |  A TG       |  A       AA G  A      A  A      G  A A  G      G  G       GC T  T       TA        GC T  T       TA        TA G  |       GT       |  C T  |       AT        AT TG        GC        GC TA        CG        CG CG        TA        TA GC        AT        TG                         TTTTTCCAGCTCCAGCTCCAGCTAAAACAAGGACTGGTTGTAATGGCGCAGTGACGGCGGTAACTTGTGCTGCATTTAATTCGGATGTAAGCATacgtacgtaatatatttttcaggttcgaagaaaattttcgagaatgcatatactctatgcattagattaaggagagcgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG0692 Uracil DNA glycosylase ... can be seen here     ..................................................................................................................