Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:145 nt.     Distance to run of Ts=1 nt.   Size=24 nt.     Delta G= -6.70 kcal/mol
Antiterminator: Size=77 nt.     Delta G= -5.53 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-13.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAAACGAGGTATTTTTAAGAAAGGTAAAGCTGATCGAGTAAAAGCTCGCGCTTCTGGA
CGCGCTTGCCCTACAGCTTAAattctctgttctttcctaattaaaattatatttggtccaaaaagcttgtgagcatgctcacttt
cgcagtttttttgggccattttattaaaaagttttttgcatcgatttaaaagcggcttgcttgtacaattttccccgaaatgcctcctttttggttataa
actttggttcccccaacattttaacgaaaagggtccttaatttttcggaggtttccaATG

    TC0908


Gene: TC0908     GI: 15835522     BI number: TC0908     GOG: NOG09590     Description: conserved hypothetical protei


            t
          a  t
          a  a
          t  a
          c  a
          c  a
          t  t
          t  t
          t  a
          c  t
          t  a
          t  t
 TG       g  t
C  G      t  t
T  A      c  g
T  C      t  g
 CG       c  t
 GC       t  c
 CG       t  c
 GC       a  a
C  T      A  a
T  T      A  a
 CG        Ta
 GC        Ta
A  C       Cg
A  |       Gc
A  |       At
A  |      C  t
T  |      A  |       at
 GC       T  |      c  g
 AT       C  |       gc
G  A      C  |       at
C  |       Cg        gc
T  |       Gt        ta
A  |       Tg        gc
 GC        Ta       |  t
 TA        Cg       |  t
 CG        Gc       t  t
 GC       C  a      t  c
 AT        Gt        cg
 AT        Cg        gc
                        agtttttttgggccattttattaaaaagttttttgcatcgatttaaaagcggcttgcttgtacaattttccccgaaatgcctcctttttggttataaactttggttcccccaacattttaacgaaaagggtccttaatttttcggaggtttccaATG


    ..................................................................................................................