                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:135 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G=-16.80 kcal/mol
Antiterminator: Size=26 nt.     Delta G= -5.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATATGCAGTTACTGTTGAGACACGCTTGATCGATGAAAGAGCAGCTCACGTAAATGCT
CAGTTCCGTTTCTAAtagcggcatataatttattagaactagcttatttttcatcaataaacactcctgtgtttctggactcggtttcg
atcgagtccagtttttctttcaaaaactttttcgccattcattccattttaactgccctcttataagttcttcctgaacaaagatgtaaaaattctgcaa
aagaagattgcagaaaaactcctcttttcactactatatcggtctacttgagcGCG

    _v6 Gene: _v6     GI: tRNA-Gly-1     BI number: tRNA-Gly-1     GOG: -------     Description: tRNA-Gl cc        tc t  t      t  g cg        ta at        gt cg        gc at        cg at        ta at        cg t  c       at a  t       gc a  g       gc cg        ta ta        cg             tttttctttcaaaaactttttcgccattcattccattttaactgccctcttataagttcttcctgaacaaagatgtaaaaattctgcaaaagaagattgcagaaaaactcctcttttcactactatatcggtctacttgagcGCG     ..................................................................................................................