                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -8.70 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-10.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTGTTTCCCCTCAAATGCTTGCTCCTATTCTCACCAAACTATACAAAGGGCCTCCCC
TCCCCTCCAAAACATTAGTTATTTCTCAAACAACAATCCAAAACGAGGATTTTATTGT
TTCTTCTGCTTTTAAAAAGGATAAACCTATCTTAATCATTGAAATTAAGAATGAGTAA
atccttttctaaaagcatttttcttaacaaaaaaccctcactcccatatactttgtcgtcgtaggaacatcgcttaccagatgggagggttactcctttc
ctctgttttcagacttaaatgattatGCC

    _v36 Gene: _v36     GI: tRNA-Leu-2     BI number: tRNA-Leu-2     GOG: -------     Description: tRNA-Le   a c  t a  c a  g gc gt at ta gc |  c        a |  a      t  c cg       t  t ta        gc gt        gc cg        gt tg        at g  g       gt ta        gc tg        gc tg       t  | cg        at at        gc             tgttttcagacttaaatgattatGCC     ..................................................................................................................