                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:145 nt.    Distance to gene:1 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G=-10.10 kcal/mol
Antiterminator:    Distance from promoter:126 nt. Size=29 nt.     Delta G= -4.80 kcal/mol
Anti-antiterminator:    Distance from promoter:104 nt.    Size=35 nt.     Delta G= -5.06 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: gtgtct-tacaat. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtgtctcacattcaagagtttctttacaataagggatgcaggcctggaggattttccgttcaggctcacttataaaacgatattttaggaaagatgtttg
ttttagggaagatgaagagttttctttaaaatagataagaaaaatagggataaagaggttttttcttgtagtaaagagagtgatcggagtaagctgatct
ttcttctcttttGCG

    _v38 Gene: _v38     GI: tRNA-Leu-3     BI number: tRNA-Leu-3     GOG: -------     Description: tRNA-Le   a t  a a  a g  g       ag        ta g  a      t  t      g  a g  g      g  a      a  g a  g       ta        gc t  t       ta        gt at        cg        cg at        ta        ta at        tg        at at        ta        gc at        tg       t  t gc       |  t       gt at        tg        at at        ta        gc tg        gt        at at        gc        gt                         ctcttttGCG     ..................................................................................................................