                                                                        Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:50 nt.    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.10 kcal/mol
Antiterminator:    Distance from promoter:13 nt. Size=44 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:    Distance from promoter:2 nt.    Size=32 nt.     Delta G= -9.39 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgctt-tacaat. It has a score value of 72.96 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcttttttctgaactttaacatacaatccgttctagcttttccagttgtgcgtgctagaacttcttgtaaagctatagcgaggactatcatgagtcct
cgtttttctcGCT

    _v40 Gene: _v40     GI: tRNA-Leu-4     BI number: tRNA-Leu-4     GOG: -------     Description: tRNA-Le             c           a  t           a  t            gc            at           t  t            cg            gt gt        ta a  t      |  a c  g      g  a c  t       cg t  g       gc        ca t  c      |  t      t  t t  g       ta       a  g t  t       gt        ta cg        ta        cg gc        tg        at at        gc        gc ta       |  g       gc cg       a  a       at ta        cg        gc ta        cg        cg gc        ta        gt                         ttttctcGCT     ..................................................................................................................