Gene putatively regulated by attenuation in C_muridarum

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:56 nt.    Distance to gene:4 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-10.90 kcal/mol
Antiterminator:    Distance from promoter:55 nt. Size=21 nt.     Delta G= -3.90 kcal/mol
Anti-antiterminator:   Size=76 nt.     Delta G=-20.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGATC-TATGCT. It has a score value of 71.62 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGATCCGGAAGAATATTCTGGATATGCTTTGGGAATGGGTATAGAGCGTCTTGCGAT
GCTTAAGTACGGAATTTCCGATATTCGATTGTTTAGCGAGAACGATTTGCGGTTTTTG
CGACAATTTTCTTAAGGA

    _v18


Gene: _v18     GI: tRNA-Ser-1     BI number: tRNA-Ser-1     GOG: -------     Description: tRNA-Se


 TG
T  C
 CG
 TA
 GT
 CG
 GC
 AT
 GT
|  A
A  A
 TG
 AT
 TA
 GC
|  G
G  G
G  A
 TA
 AT
 AT
 GT                  TT
 GC                 T  G
 GC                 A  C
 TG                 G  G
 TA                  CG
|  T                 AT
|  A                 AT
|  T                 GT
|  T                 AT
T  C        C        GT
C  G      G  G       CG
G  A      A  A       GC
T  T       TG       A  |
 AT        TA       T  |
 TG        TA        TG
 AT        GC        TA
 GT        TG        GC
 GT        TA        TA
 TA        AT        TA
 CG        GT        AT
                        TTTCTTAAGGA


    ..................................................................................................................