                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:70 nt.    Distance to gene:49 nt.     Distance to run of Ts=0 nt.   Size=19 nt.     Delta G= -6.00 kcal/mol
Antiterminator:    Distance from promoter:33 nt. Size=47 nt.     Delta G=-12.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcca-taaact. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgccattaactgtcttccagctaaactagggatgagtcctttcccaaaggccttcttaagaccttccttgacttcggttcatccgtaataagtttcaag
gagttggtacagcttcttgttttgctgaaaataatgaaaacacttcaactgctagggttatcttatatagATG

    ybbP --- CT011 Gene: ybbP     GI: 15604730     BI number: CT012     GOG: COG1624     Description: hypothetical protein Gene: CT011     GI: 15604729     BI number: CT011     GOG: NOG04832     Description: hypothetical protei   c t  a t  t gc gc cg |  t |  a |  a |  t ta ta cg |  t |  t at gc ta ta         t cg       g  a cg        gc ta        ta tg        tg |  t       gc |  t       at cg        gt cg        gc at        at             tgttttgctgaaaataatgaaaacacttcaactgctagggttatcttatatagATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1624 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................