                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-17.60 kcal/mol
Antiterminator: Size=65 nt.     Delta G=-13.47 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTTCTTGAAACGATACAGTGGCATTAAGCAGTCTGCTCCTAAGCCTGAAACCGTTGT
GGAAGATGTTCTTCCCAAGGGTAAGAAGAAATCTCCTGCTAAGAAGAAAAAATAGtttg
aacagaactttctgttatctagagaaaagcggggcgaacaccccgctttttttgttttaataagtctctctttttgaatctgacttttcagagtaaagtc
tagtgttccccaaaaattgattgccaatgtacactctggtctttgttagagagatactagagtaaaggcagaagaagtcgttcATG

    pfrA --- CT024 --- ffh --- rs16 --- trmD --- rl19 Gene: pfrA     GI: 15604741     BI number: CT023     GOG: COG0216     Description: Peptide Chain Releasing Factor (RF-1) Gene: CT024     GI: 15604742     BI number: CT024     GOG: COG2890     Description: N6-adenine-specific DNA methylase Gene: ffh     GI: 15604743     BI number: CT025     GOG: COG0541     Description: Signal Recognition Particle GTPase Gene: rs16     GI: 15604744     BI number: CT026     GOG: COG0228     Description: S16 Ribosomal Protein Gene: trmD     GI: 15604745     BI number: CT027     GOG: COG0336     Description: tRNA (guanine N-1) Methyltransferase Gene: rl19     GI: 15604746     BI number: CT028     GOG: COG0335     Description: L19 Ribosomal Protei ct a  t at gc at cg at at g  a t  t t  | t  | Gc At Ta A  g A  a A  g A  a A  a A  a G  | A  |       aa A  |      g  c G  |      c  a A  |       gc A  |       gc Ta        gc Cg        gc Gc        cg Tg        gc Cg        at Cg        at Tg        at |  c       at Cg        gt Ta        at             tgttttaataagtctctctttttgaatctgacttttcagagtaaagtctagtgttccccaaaaattgattgccaatgtacactctggtctttgttagagagatactagagtaaaggcagaagaagtcgttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0216 Protein chain release factor A ... can be seen here [J] COG2890 Methylase of polypeptide chain release factors ... can be seen here [U] COG0541 Signal recognition particle GTPase ... can be seen here [J] COG0228 Ribosomal protein S16 ... can be seen here [J] COG0336 tRNA-(guanine-N1)-methyltransferase ... can be seen here [J] COG0335 Ribosomal protein L19 ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:134 nt.     Distance to run of Ts=0 nt.   Size=16 nt.     Delta G= -8.00 kcal/mol Antiterminator: Size=65 nt.     Delta G=-13.47 kcal/mol Anti-antiterminator:   Size=53 nt.     Delta G= -6.32 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AGTTCTTGAAACGATACAGTGGCATTAAGCAGTCTGCTCCTAAGCCTGAAACCGTTGT GGAAGATGTTCTTCCCAAGGGTAAGAAGAAATCTCCTGCTAAGAAGAAAAAATAGtttg aacagaactttctgttatctagagaaaagcggggcgaacaccccgctttttttgttttaataagtctctctttttgaatctgacttttcagagtaaagtc tagtgttccccaaaaattgattgccaatgtacactctggtctttgttagagagatactagagtaaaggcagaagaagtcgttcATG     pfrA --- CT024 --- ffh --- rs16 --- trmD --- rl19 Gene: pfrA     GI: 15604741     BI number: CT023     GOG: COG0216     Description: Peptide Chain Releasing Factor (RF-1) Gene: CT024     GI: 15604742     BI number: CT024     GOG: COG2890     Description: N6-adenine-specific DNA methylase Gene: ffh     GI: 15604743     BI number: CT025     GOG: COG0541     Description: Signal Recognition Particle GTPase Gene: rs16     GI: 15604744     BI number: CT026     GOG: COG0228     Description: S16 Ribosomal Protein Gene: trmD     GI: 15604745     BI number: CT027     GOG: COG0336     Description: tRNA (guanine N-1) Methyltransferase Gene: rl19     GI: 15604746     BI number: CT028     GOG: COG0335     Description: L19 Ribosomal Protei            ga ct       a  a a  t       ga at        aa gc        tg at        cc cg        tg at        ag at       t  g g  a      t  g t  t      g  | t  |      t  | t  |       cc Gc        tg At        ta Ta       t  a A  |      c A  |      a A  |      a A  |      g A  |      a A  |      c  | G  |      a  | A  |      a  | A  |      g  | G  |      t  | A  |      t  | A  |       t T  |       G C  |       A        aa G  |       T       g  c T  |       A       c  a C  |       A        gc Cg        A        gc Ta       |         gc Cg        A        gc Ta        A        cg                         ctttttttgttttaataagtctctctttttgaatctgacttttcagagtaaagtctagtgttccccaaaaattgattgccaatgtacactctggtctttgttagagagatactagagtaaaggcagaagaagtcgttcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0216 Protein chain release factor A ... can be seen here [J] COG2890 Methylase of polypeptide chain release factors ... can be seen here [U] COG0541 Signal recognition particle GTPase ... can be seen here [J] COG0228 Ribosomal protein S16 ... can be seen here [J] COG0336 tRNA-(guanine-N1)-methyltransferase ... can be seen here [J] COG0335 Ribosomal protein L19 ... can be seen here     ..................................................................................................................