Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:51 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G= -8.50 kcal/mol
Antiterminator: Size=44 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gtaagaaaataagaaggcgcaagctcgttcccttcggtctattatgtgttgaacgtacgcttctaaaacacgctttagtttcggtaaacttaatctagcc
gtagatccaactaggggacattgtcacaggatattttttttggttattttccgcaatactctatagagaatacttgtattcacgaaaaaatcggtcctag
tgtacagttttctctgaagataaagaggttccgaagggacgtcttttatttgaaaaagagaaattcacaggaagtttcgtatagataaggatggtttttt
ATG

    ssb


Gene: ssb     GI: 15604763     BI number: CT044     GOG: COG0629     Description: SS DNA Binding Protei


 tt
t  c
t  t
 gc
 at
 cg
|  a
|  a
a  g
 ta
 gt
 ta
|  a        a
g  a      g  a
a  g       cg
 ta        cg
 cg        tg
 cg        ta
|  t       gc
t  t      g  g
 gc        at
 gc        gc
 cg        at
 ta        at
            ttatttgaaaaagagaaattcacaggaagtttcgtatagataaggatggttttttATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[L] COG0629 Single-stranded DNA-binding protein ... can be seen here

    ..................................................................................................................