Gene putatively regulated by attenuation in C_trachomatis
Characteristics of the secondary structures
Terminator: Distance from promoter:80 nt. Distance to gene:65 nt. Distance to run of Ts=0 nt. Size=37 nt. Delta G=-17.10 kcal/mol
Antiterminator: Distance from promoter:50 nt. Size=48 nt. Delta G= -5.40 kcal/mol
Anti-antiterminator: Distance from promoter:11 nt. Size=52 nt. Delta G= -3.60 kcal/mol
Nomenclature/Definitions
The most likely promoter is: TTGCCT-CAGGAT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator
structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case
TTGCCTTACCCCAAATATGCAACAGGATTTGGTGTGCGTTGTTTAATTCATTATATGG
AGAAATTCCTATCTAAATAGttattgtttagcgatattaaataattgtgtgtggttagtttttaataaaaagttaaaaactaacc
attttttattaaagtttttcattctccctgtcgatagatcaaataagtagtagttacctgtctaattaggggaATG
hctB
Gene: hctB GI: 15604765 BI number: CT046 GOG: NOG06624 Description: Histone-like Protein
TT
A C a
A C t a
A T a t
G A a t
AT a g
GC t t
GT tg
TA at a
A A tg a a
TA at a a
AT g g tg
TA cg at
TG gt at
At at ta
| t ta ta
| a tg ta
C t | t ta
T t | t ta
Tg | t gc
At t t at
At gt ta
T t ta ta
Ta ta gc
Tg at gc
Gc ta ta
Tg ta gt
tttttattaaagtttttcattctccctgtcgatagatcaaataagtagtagttacctgtctaattaggggaATG
..................................................................................................................