                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:84 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-15.60 kcal/mol
Antiterminator: Size=43 nt.     Delta G= -8.50 kcal/mol
Anti-antiterminator:   Size=52 nt.     Delta G= -5.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AACATAAACATACTGCAGCTTGTGGACGTGTAGCTGCTTCTGGTGTAAAGGTTTGCGC
TTCTGCAGCTAAAAGAAAAACGAATCCTAACCGTTCTCGTACAGCTCACAGTTGGCGT
CAACAATTAATGAAATTAGTCGCTAGATAGtcgtatcgctttcgatgattttctaagtagccgggaataagaattctc
ttttcccggttttttgtatttattggctgagtcgaaatgtcttaagaagataaaatctgggaacaaaaagaataatcccagaattattgggttttggcga
tggattATG

    CT047 Gene: CT047     GI: 15604766     BI number: CT047     GOG: COG1466     Description: hypothetical protei   T A  G A  A TA TA AT AT |  A       tt CG       c  t AT        gc A  |       cg C  |       ta T  |       at GC       t  | CG       g  |       tt GC        cg       a  c GT        ta        at TA        Gt        gc TG        At        at G  A      T  t       at A  T       At       t  | C  |       Gc        at A  |       At        at C  |      |  a       gc TA        Ta        gc CG        Cg        gc Gt       G  t       cg A  c      C  a       cg Cg        Tg        gt At        Gc        at                         ttttgtatttattggctgagtcgaaatgtcttaagaagataaaatctgggaacaaaaagaataatcccagaattattgggttttggcgatggattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1466 DNA polymerase III, delta subunit ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-15.60 kcal/mol Antiterminator: Size=43 nt.     Delta G= -8.50 kcal/mol Anti-antiterminator:   Size=33 nt.     Delta G= -3.60 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case AACATAAACATACTGCAGCTTGTGGACGTGTAGCTGCTTCTGGTGTAAAGGTTTGCGC TTCTGCAGCTAAAAGAAAAACGAATCCTAACCGTTCTCGTACAGCTCACAGTTGGCGT CAACAATTAATGAAATTAGTCGCTAGATAGtcgtatcgctttcgatgattttctaagtagccgggaataagaattctc ttttcccggttttttgtatttattggctgagtcgaaatgtcttaagaagataaaatctgggaacaaaaagaataatcccagaattattgggttttggcga tggattATG     CT047 Gene: CT047     GI: 15604766     BI number: CT047     GOG: COG1466     Description: hypothetical protei            at           g  t            tt            at            gc            ct ta       t  | g  t      t  |       tt c  c       ta       a  c tg        ca        at Gc        gg        gc At        ct        at T  t      t  a       at At        ag       t  | Gc        tc        at A  g       gc        at T  a      |  g       gc C  |       cg        gc Gt        tg        gc Cg       G  a       cg Ta       A  a       cg Gt        Tt        gt At        Aa        at                         ttttgtatttattggctgagtcgaaatgtcttaagaagataaaatctgggaacaaaaagaataatcccagaattattgggttttggcgatggattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1466 DNA polymerase III, delta subunit ... can be seen here     ..................................................................................................................