                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:121 nt.     Distance to run of Ts=1 nt.   Size=32 nt.     Delta G=-21.10 kcal/mol
Antiterminator: Size=60 nt.     Delta G=-12.70 kcal/mol
Anti-antiterminator:   Size=29 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTCTTGGCTGCATCCGCTGCTAAAGAACAGGAATTAGCAGAAGCTGCAGCAGCAGAG
AAGGAAGCTTCTTCTGCGGCTAAAGAATCCGCTCCTGCTATAGAAGGTGTTTCTTAAt
aagactttctaaaaattctctaaaaagaagccccgttctatctcggacggggcttttcttttgtctttaaaaatcccctcgccttttttataaactcttc
tagatctagattacttttctctagatagacaactcacaattccgttaacatgtccttttcgaagcaaaaactcggttaaaaacaTTG

    lepA Gene: lepA     GI: 15604783     BI number: CT064     GOG: COG0481     Description: GTPas            ta           c  a            ta            ta            ta           c  t            at            gc            at           |  c           a  t           t  a           A  a           A  a            Ta            Ta        tc   T        Cg       a  t T  A       Ta       t  c C  A       Ta        cg T  t       Tg        tg Ta        Gc        ta Ta       T  c       gc G  g       Gc        cg Ta        Gc        cg Gc       |  g       cg Gt        At        cg At        At        gc At        Gc        at Gc        At        at At        Ta        gt Ta        At        at                         cttttgtctttaaaaatcccctcgccttttttataaactcttctagatctagattacttttctctagatagacaactcacaattccgttaacatgtccttttcgaagcaaaaactcggttaaaaacaTTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG0481 Membrane GTPase LepA ... can be seen here     ..................................................................................................................