                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:107 nt.    Distance to gene:81 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-10.20 kcal/mol
Antiterminator:    Distance from promoter:75 nt. Size=39 nt.     Delta G= -7.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcct-tatact. It has a score value of 76.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgccttccgagacctttggtggtatactcttttcctaaaggttggatttctgccattttttattccgccctcctgggctccttgagtggagggcatctc
ctcctcacgtaatcgaagattcagccggaatagggagtcgtgaaatcaaaattttttcacgactttttaaagaaatactttaaatcttcgttgatttgat
caacaaagaaaacttaacaataaacacaagcttttcagagggtgaaatATG

    CT065 Gene: CT065     GI: 15604784     BI number: CT065     GOG: COG3202     Description: ADP/ATP Translocas   c g  c a  g cg ta ta at g  a        a a  g      a  a a  g      a  t g  |      c  t cg       t  t ta        at a  g       at a  t       at t  |       gc gc        ta cg        gc at        cg cg        ta ta        gc             tttttaaagaaatactttaaatcttcgttgatttgatcaacaaagaaaacttaacaataaacacaagcttttcagagggtgaaatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG3202 ATP/ADP translocase ... can be seen here     ..................................................................................................................