                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:177 nt.     Distance to run of Ts=0 nt.   Size=28 nt.     Delta G= -7.00 kcal/mol
Antiterminator: Size=60 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:   Size=16 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttagttgttaaaattatttagaattgtctcttcgagatgagaaacgcgctagattttccttttggttgaggatataaattcattctgttaaaagtatctt
tgcgataagcgaggttctttttttggagggggagctccttacaggaggcttgtatcctttaaaatagagtttttcttatgatcccatgtggcgataggcc
gggtctagcgccgatagtagaaatatcggttggtttttgtccttaggggatcgtatactttttcaaagtatgtccccgtatcgattatctggaggctctt
ATG

    ytgA --- ytgB_1 --- ytgC --- ytgD --- yaeM Gene: ytgA     GI: 15604786     BI number: CT067     GOG: COG0803     Description: Solute Protein Binding Family Gene: ytgB_1     GI: 15604787     BI number: CT068     GOG: COG1121     Description: rRNA methylase Gene: ytgC     GI: 15604788     BI number: CT069     GOG: COG1108,COG1321     Description: Integral Membrane Protein Gene: ytgD     GI: 15604789     BI number: CT070     GOG: COG1108     Description: Integral Membrane Protein Gene: yaeM     GI: 15604790     BI number: CT071     GOG: COG0743     Description: hypothetical protei             a           t  a           a  a           t  t            at            gc           |  a            gt            at            gc           t  t           t  g            gt            gt            ta            ta            ta            ta            cg         t           c  t      a  a           t  |      g  a           t  |       cg           t  |       gc            ta        tg            at        ta gg        gc        tg t  t       at        cg t  t      t  t      t  t tg       c  |      a  t ta        gt       t  | cg        cg        gc cg        gc        at ta        cg        at                         tttttggagggggagctccttacaggaggcttgtatcctttaaaatagagtttttcttatgatcccatgtggcgataggccgggtctagcgccgatagtagaaatatcggttggtttttgtccttaggggatcgtatactttttcaaagtatgtccccgtatcgattatctggaggctcttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0803 ABC-type metal ion transport system, periplasmic component/surface adhesin ... can be seen here [P] COG1121 ABC-type Mn/Zn transport systems, ATPase component ... can be seen here [P] COG1108 ABC-type Mn2+/Zn2+ transport systems, permease components ... can be seen here [K] COG1321 Mn-dependent transcriptional regulator ... can be seen here [P] COG1108 ABC-type Mn2+/Zn2+ transport systems, permease components ... can be seen here [I] COG0743 1-deoxy-D-xylulose 5-phosphate reductoisomerase ... can be seen here     ..................................................................................................................