                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:207 nt.     Distance to run of Ts=0 nt.   Size=17 nt.     Delta G= -6.00 kcal/mol
Antiterminator: Size=37 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:   Size=33 nt.     Delta G= -3.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTAGGAAGACCTACTATTCCACACTCTGTTTGTCCCATTTTCATtacctaagaagttgtacagcttt
ttcttaaggctaacacagcctttttattattaaggaaaaagaaattctaaagaaaaagcaagattagtgcttcatgaaaaacgctctttaaaaaaaatat
tccgttctctaaagaaccccttactctttgtttataaatgggatgagcatctgccaccttctttcttgagaaaaacatttatatacggtaacttgcgaag
tattccttatagcgcttaagcaactggccatctATG

    yscU --- lcrD --- lcrE --- sycE --- malQ Gene: yscU     GI: 15604810     BI number: CT091     GOG: COG1377     Description: Yop proteins translocation protein U Gene: lcrD     GI: 15604809     BI number: CT090     GOG: COG4789     Description: Low Calcium Response D Gene: lcrE     GI: 15604808     BI number: CT089     GOG: NOG26771     Description: Low Calcium Response E Gene: sycE     GI: 15604807     BI number: CT088     GOG: NOG06344     Description: Secretion Chaperone Gene: malQ     GI: 15604806     BI number: CT087     GOG: COG1640     Description: 4-alpha glucanotransferas             c           a  a            tg   G        gc T  T      t  t A  t      t  t t  a       gt c  c       at t  c       at a  t       gc c  a       at c  a       at         c g  g      |  a      a  a g  a       ta       a  c ta        cg        ta cg        cg        cg at       |  c       gc at        at        gc cg        ta        at gt        Ta        at                         tttattattaaggaaaaagaaattctaaagaaaaagcaagattagtgcttcatgaaaaacgctctttaaaaaaaatattccgttctctaaagaaccccttactctttgtttataaatgggatgagcatctgccaccttctttcttgagaaaaacatttatatacggtaacttgcgaagtattccttatagcgcttaagcaactggccatctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [NU] COG1377 Flagellar biosynthesis pathway, component FlhB ... can be seen here [U] COG4789 Type III secretory pathway, component EscV ... can be seen here [G] COG1640 4-alpha-glucanotransferase ... can be seen here     ..................................................................................................................