Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:54 nt.    Distance to gene:59 nt.     Distance to run of Ts=0 nt.   Size=21 nt.     Delta G= -6.40 kcal/mol
Antiterminator:    Distance from promoter:37 nt. Size=23 nt.     Delta G= -3.80 kcal/mol
Anti-antiterminator:    Distance from promoter:13 nt.    Size=29 nt.     Delta G= -3.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tcgaca-taaaat. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcgacacacaaaatctaaaactaaaattacacagaaactagtgaaactttttttaataaagagatgcatcttattacttgtagtgcaagggaaatcttgc
cttttttaaggtgaatatttacactactctttttgactttgtagtttttaggagaacatcattaaATG

    rs1


Gene: rs1     GI: 15604817     BI number: CT098     GOG: COG0539     Description: S1 Ribosomal Protei


  a
t  a
t  t
 ta         a
 ta       t  c       aa
 ta       t  t      g  a
 tg        at        gt
 ta        tg        gc
 cg       t  t       at
a  a      c  a       at
a  t       tg        cg
a  g       at        gc
 gc        cg       t  |
 ta        gc        gc
 gt        ta        at
                        tttttaaggtgaatatttacactactctttttgactttgtagtttttaggagaacatcattaaATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0539 Ribosomal protein S1 ... can be seen here

    ..................................................................................................................