                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:162 nt.    Distance to gene:64 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-17.80 kcal/mol
Antiterminator:    Distance from promoter:142 nt. Size=34 nt.     Delta G= -6.10 kcal/mol
Anti-antiterminator:    Distance from promoter:118 nt.    Size=42 nt.     Delta G= -8.30 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGAAG-TAAAGT. It has a score value of 65.6 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGAAGCTGGTATTTTAGATCCTGCTAAAGTAACCCGTTCTGCTTTAGAAAGCGCGGC
TTCCGTAGCTGGATTACTTTTGACAACAGAAGCTCTCATTGCAGAGATTCCAGAAGAA
AAACCTGCTGCAGCTCCAGCAATGCCTGGCGCAGGAATGGACTATTAAttcctctaatgggaac
aaatagattcttcgagcctcgtttccaaaaggaacgaggcttttttttagattcctaatatttctctattcctctatcgtaaacatctagtgcttacgac
catccttttctATG

    CT109 Gene: CT109     GI: 15604828     BI number: CT109     GOG: NOG05406     Description: CHLPS hypothetical protei   a t  a c  t tg cg cg        tc ta       t  t ta        at A  c       gc         a A  a      |  g      a  a Ta       |  a      c  a Ta       a  g       cg At       t  c       tg Ta       a  c       ta Cg       a  t       ta A  |      a  c       gc G  |       cg        cg G  |       at        ta Ta        at        cg At        gt        cg At        gc        gc Gc        gc        at Gt        ta        gt                         ttttttagattcctaatatttctctattcctctatcgtaaacatctagtgcttacgaccatccttttctATG     ..................................................................................................................