Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=3 nt.   Size=23 nt.     Delta G=-10.90 kcal/mol
Antiterminator: Size=67 nt.     Delta G=-12.40 kcal/mol
Anti-antiterminator:   Size=64 nt.     Delta G=-18.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TAAAGTTGCGAAACTCGTAGTTGCTCTCGCCGCTCTTGTTTTGAATGGGGCTTTGTGT
GTTCTTTCACTGGTTGCTTTATGTGTGGGAGCTACTCCTGTAGGGCCTTTAGCCGTTT
TAGTAGCGACAACACTGGCGAGCTTCTTGTGTGCAGCTTGTGTTTTGTTTATAGCTGC
TAAGGATCGGGGATGGATCGCTTCTACAAATAAGTGCTAGgcaaaactcgaaaagcagacttcctctagg
tctgctagctcttttaatgacaagaaacgaaatttgataaagggatagggggatacATG

    CT118


Gene: CT118     GI: 15604837     BI number: CT118     GOG: NOG14008     Description: hypothetical protei


           CA
  T       A  A
T  G      T  A
T  T      C  T
T  T       TA
 GT        TA
 TA        CG
 GT        GT
T  |       CG
 TA       |  C
 CG       |  T
 GC       T  A
 AT       A  G
 CG       G  g
 GC        Gc
|  T       Ta
|  A      |  a
|  A      A  a
|  G      G  a
T  G       Gc
G  A       Gt
T  T       Gc
 GC        Cg
 TG        Ta
 TG       A  a
 CG       G  a        t
 TG       G  |      c  c
 TA       A  |      c  t
|  T      A  |       ta
|  G       Ta        tg
C  G       Cg        cg
G  A       Gc        at
 AT        Ta        gc
 GC        Cg        at
 CG       |  a       cg
 GC        Gc        gc
 GT        At        at
                        agctcttttaatgacaagaaacgaaatttgataaagggatagggggatacATG


    ..................................................................................................................