                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=26 nt.     Delta G= -7.90 kcal/mol
Antiterminator: Size=41 nt.     Delta G=-12.70 kcal/mol
Anti-antiterminator:   Size=60 nt.     Delta G=-13.74 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCTTGAGAAAATGCAGCGATTCCCTAAAGAATTCCTTAAAGATGGTGTAGCGAAAAGT
GTTGTTGCGATTCAAGCTGGGGAATCTTTGGATACAGGAGAGTTGGCTTGGGAAGAGA
TGCCGAGCATCACAGCTTGTTTAGGAAGAGAGGGAATGGATGCTCAGGCGTATTCCTT
TCTTTCTGCAAGTCCTTTAGATGCGCGTATAGAGTAAacggtttcgaaaaaagaattttctgctcatagcggc
ggatttgtggtatagtgctccctaaagctttagatcagcttttagggagatatATG

    CT136 --- ywlC --- CT138 Gene: CT136     GI: 15604855     BI number: CT136     GOG: COG0400     Description: predicted Lysophospholipase esterase Gene: ywlC     GI: 15604856     BI number: CT137     GOG: COG0009     Description: SuA5 Superfamily-related Protein Gene: CT138     GI: 15604857     BI number: CT138     GOG: COG2355     Description: Dipeptidas   A G  G A  A A  T G  G GC GC TG TA CG GC        GG G  A      A  A T  T       TA T  C       TG G  A       TA A  C      G  G G  A       TA A  G       TG GC        CG        CA GT       |  G      T  G AT       |  A       CG CG       G  A       GC AT        AT        TG T  T       CG        AT A  T      A  |      G  | G  |       CG       G  | G  |       TA        TA T  |       AT        AT TA        CG        AT TG        GC        GC CG        AT        GC TA        GC        GT                         TTCTTTCTGCAAGTCCTTTAGATGCGCGTATAGAGTAAacggtttcgaaaaaagaattttctgctcatagcggcggatttgtggtatagtgctccctaaagctttagatcagcttttagggagatatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0400 Predicted esterase ... can be seen here [J] COG0009 Putative translation factor (SUA5) ... can be seen here [E] COG2355 Zn-dependent dipeptidase, microsomal dipeptidase homolog ... can be seen here     ..................................................................................................................