                                                                        Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:90 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.50 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTTGTAATCGAACGGTTGAGGGTTCAATTCCTTTCTCCAGCAtctttttttGGGGGTGTCG
CATAGCGGTCAATTGCATCGGACTGTAAATCCGACTCCTTACGGATACGTTGGTTCAA
ATCCAGCCACCCCCAggacctcataaaaatcctatcagaaatcgattatttgcgaagcttgggttctcccaggctttttttatgctctt
tttcatccaagttttatttaaaaaaagaattagttttgacttctaattaatagtttgctttttattcaaaataaaaacttggaaacaattaaATG

    CT142 --- CT143 --- CT144 Gene: CT142     GI: 15604861     BI number: CT142     GOG: NOG06291     Description: hypothetical protein Gene: CT143     GI: 15604862     BI number: CT143     GOG: NOG06985     Description: hypothetical protein Gene: CT144     GI: 15604863     BI number: CT144     GOG: NOG06640     Description: hypothetical protei at t  t t  t a  g gc cg ta a  a a  g a  |       tc gc       t  t at        gc c  t       gc t  |       gc a  |       ta t  |       tg cg        cg cg        gc tg        at at        at at        gt             ttttatgctctttttcatccaagttttatttaaaaaaagaattagttttgacttctaattaatagtttgctttttattcaaaataaaaacttggaaacaattaaATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_trachomatis                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:100 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-14.50 kcal/mol Antiterminator: Size=38 nt.     Delta G= -4.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red The sequences of the antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case TTTGTAATCGAACGGTTGAGGGTTCAATTCCTTTCTCCAGCAtctttttttGGGGGTGTCG CATAGCGGTCAATTGCATCGGACTGTAAATCCGACTCCTTACGGATACGTTGGTTCAA ATCCAGCCACCCCCAggacctcataaaaatcctatcagaaatcgattatttgcgaagcttgggttctcccaggctttttttatgctctt tttcatccaagttttatttaaaaaaagaattagttttgacttctaattaatagtttgctttttattcaaaataaaaacttggaaacaattaaATG     CT142 --- CT143 --- CT144 Gene: CT142     GI: 15604861     BI number: CT142     GOG: NOG06291     Description: hypothetical protein Gene: CT143     GI: 15604862     BI number: CT143     GOG: NOG06985     Description: hypothetical protein Gene: CT144     GI: 15604863     BI number: CT144     GOG: NOG06640     Description: hypothetical protei ga a  a c  a t  t ac tg ca c  t t  t a  |       tc aa       t  t at        gc a  t       gc a  |       gc t  |       ta a  |       tg ct        cg tg        gc cc        at cg        at aa        gt             ttttatgctctttttcatccaagttttatttaaaaaaagaattagttttgacttctaattaatagtttgctttttattcaaaataaaaacttggaaacaattaaATG     ..................................................................................................................