Gene putatively regulated by attenuation in C_trachomatis

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:127 nt.     Distance to run of Ts=2 nt.   Size=28 nt.     Delta G=-15.70 kcal/mol
Antiterminator: Size=63 nt.     Delta G=-11.63 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -4.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCAGCAACATACTATGCAACTTCTTCAGGATTTTTCCAATTGATTGTGGGAGAGCGA
AACTTTCGTGTTTCTTCTCTCTCTTGGAGTGTGGTTCGGCTACCTGTTGTTCCTTAAc
ggagctcttttctatttacaccgcttagcttgctttagttaagcggttcctttttatcaaaacaaaataagagatcttttgttgtagacggatcggaaag
ctacaagtatagtactgggaagagcaaatcgcttaataggttcaagtaaagaaacttcgcaataaggttagaggtcccgaggagATG

    CT145 --- dnlJ


Gene: CT145     GI: 15604864     BI number: CT145     GOG: COG0515,COG1262     Description: Serine/threonine Protein Kinase
Gene: dnlJ     GI: 15604865     BI number: CT146     GOG: COG0272     Description: DNA Ligas


            A
          T  A
          T  c
           Cg
           Cg
           Ta
           Tg
           Gc
          |  t
          T  c
          T  t
          G  t
          T  t
          C  t
          C  c
          A  t
          T  a
          C  t
          G  t
          G  t
          C  a       ct
          T  c      g  t
           Ta       t  t
  C        Gc        ta
A  C       Gc        cg
T  T       Tg        gt
 CG        Gc        at
 GT       |  t       ta
 GT       |  t       ta
 CG       |  a       cg
T  T       Tg        gc
T  T       Gc        cg
 GC        At        cg
 GC        Gt        at
                        tcctttttatcaaaacaaaataagagatcttttgttgtagacggatcggaaagctacaagtatagtactgggaagagcaaatcgcttaataggttcaagtaaagaaacttcgcaataaggttagaggtcccgaggagATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[RTKL] COG0515 Serine/threonine protein kinase ... can be seen here
[S] COG1262 Uncharacterized conserved protein ... can be seen here
[L] COG0272 NAD-dependent DNA ligase (contains BRCT domain type II) ... can be seen here

    ..................................................................................................................